| BP920297 |
| Clone id |
YMU001_000135_D04 |
| Library |
YMU01 |
| Length |
204 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000135_D04. |
| Accession |
BP920297 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL155Contig1 |
| Sequence |
GAGTACCGTGCGAGAGAGAGAGGGGATTTCGTTTGGCTGCAGCAATGCGCAAATCACACA CTAATATATATAGTGAGCAAGCTTAGAAAGTGTGACCATAAAATGCACTTTAACATGTCA AGGAAGAACCATAAAGTTTATAACATTTATCTATGTGTCACCTGTGTGGGGATCTCACAA AGCCTACCATAGGTGCATCTCTAG |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
A6NGH9 |
| Definition |
sp|A6NGH9|YR003_HUMAN Putative zinc finger protein ENSP00000328166 OS=Homo sapiens |
| Align length |
62 |
| Score (bit) |
28.9 |
| E-value |
8.4 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
Q9ZR47 |
| Definition |
tr|Q9ZR47|Q9ZR47_DAUCA Neutral invertase OS=Daucus carota |
| Align length |
45 |
| Score (bit) |
36.2 |
| E-value |
0.83 |
| Report |
 |