BP920423 | |
Clone id | YMU001_000136_H07 |
Library | YMU01 |
Length | 400 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000136_H07. |
Accession | BP920423 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2442Contig1 |
Sequence | GAAATCGAAAGGTTTGCGCTCTCTTCCTTCACCTCCTTCTCCTGACTATGCGTATGCTCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | B1ARI9 |
Definition | sp|B1ARI9|CQ072_MOUSE Uncharacterized protein C17orf72 homolog OS=Mus musculus |
Align length | 46 |
Score (bit) | 31.6 |
E-value | 1.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7UTV4 |
Definition | tr|A7UTV4|A7UTV4_ANOGA AGAP005741-PA OS=Anopheles gambiae |
Align length | 61 |
Score (bit) | 33.9 |
E-value | 4.1 |
Report | BLASTX 2.2.19 [Nov-02-2008] |