| BP920423 | |
| Clone id | YMU001_000136_H07 |
| Library | YMU01 |
| Length | 400 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000136_H07. |
| Accession | BP920423 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2442Contig1 |
| Sequence | GAAATCGAAAGGTTTGCGCTCTCTTCCTTCACCTCCTTCTCCTGACTATGCGTATGCTCT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | B1ARI9 |
| Definition | sp|B1ARI9|CQ072_MOUSE Uncharacterized protein C17orf72 homolog OS=Mus musculus |
| Align length | 46 |
| Score (bit) | 31.6 |
| E-value | 1.3 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7UTV4 |
| Definition | tr|A7UTV4|A7UTV4_ANOGA AGAP005741-PA OS=Anopheles gambiae |
| Align length | 61 |
| Score (bit) | 33.9 |
| E-value | 4.1 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |