| BP920426 | |
| Clone id | YMU001_000136_H10 |
| Library | YMU01 |
| Length | 438 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000136_H10. |
| Accession | BP920426 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL339Contig1 |
| Sequence | AGGTACTCGAGTACCTGCTGGGCTGGGAAATGAAGCTTTACTCATGCCAAATCTGCTATC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5H9K5 |
| Definition | sp|Q5H9K5|ZMAT1_HUMAN Zinc finger matrin-type protein 1 OS=Homo sapiens |
| Align length | 65 |
| Score (bit) | 30.4 |
| E-value | 3.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q0WNB7 |
| Definition | tr|Q0WNB7|Q0WNB7_ARATH Putative uncharacterized protein At3g50480 OS=Arabidopsis thaliana |
| Align length | 61 |
| Score (bit) | 33.5 |
| E-value | 5.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |