| BP920497 | |
| Clone id | YMU001_000137_G08 |
| Library | YMU01 |
| Length | 607 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000137_G08. |
| Accession | BP920497 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL4100Contig1 |
| Sequence | CTCAAGTATTATGCAGACGATCTTCAGGCAGCAAGGACCAACTATGCGAGGTCTTTAGAC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q9WV70 |
| Definition | sp|Q9WV70|NOC2L_MOUSE Nucleolar complex protein 2 homolog OS=Mus musculus |
| Align length | 101 |
| Score (bit) | 30.8 |
| E-value | 5.6 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B4FS59 |
| Definition | tr|B4FS59|B4FS59_MAIZE Putative uncharacterized protein OS=Zea mays |
| Align length | 97 |
| Score (bit) | 116.0 |
| E-value | 1.0e-24 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |