BP920506
Clone id YMU001_000137_H05
Library
Length 224
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000137_H05.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
TTTGGTGGGTGTGTCGGCTCAACCCCCATTGGTGTAGCTCTGCACTGACCATTGGGTGTG
AAAGGAGCATGATGTTAATCATTCAAATTAGAGATCTTCACATTACAAAACAAGGTGAAG
CATTATGATACCTGCTACACCATTGGGAACATTGATGAAAGAGCCTCTTCAAAGAAAGCC
GCAAGCAAATGGTGCATTGTTCATAGTTGGCAATGAGTAAATCC
■■Homology search results ■■ -
sp_hit_id Q4IL82
Definition sp|Q4IL82|INO80_GIBZE Putative DNA helicase INO80 OS=Gibberella zeae
Align length 30
Score (bit) 31.6
E-value 1.3
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP920506|Adiantum capillus-veneris mRNA, clone:
YMU001_000137_H05.
(224 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q4IL82|INO80_GIBZE Putative DNA helicase INO80 OS=Gibberella ... 32 1.3

>sp|Q4IL82|INO80_GIBZE Putative DNA helicase INO80 OS=Gibberella
zeae GN=INO80 PE=3 SV=1
Length = 1904

Score = 31.6 bits (70), Expect = 1.3
Identities = 14/30 (46%), Positives = 16/30 (53%)
Frame = -1

Query: 92 SNLND*HHAPFTPNGQCRATPMGVEPTHPP 3
+ L+ HH P P Q RA P V P HPP
Sbjct: 157 AGLHQRHHQPGAPAHQHRAAPPPVSPLHPP 186


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP920506|Adiantum capillus-veneris mRNA, clone:
YMU001_000137_H05.
(224 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******