BP920532 |
Clone id |
YMU001_000138_C06 |
Library |
YMU01 |
Length |
193 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000138_C06. |
Accession |
BP920532 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
CL1433Contig1 |
Sequence |
ATCCCAGATGCCAAAGCCAGTGCCCAATGCCAGACCAGCACCTTTCCACAATGACTTCGA GATGCTGAGACCAGATCCAGTAATAGTTCCCCCCACGAGTTTAAGGTAATCAGCTCCAAA GATGACACCACTCTTCTGCGGCCGAGTGATATCATACACAATCGTCGCAACTCTATACAC ATCTACTCCTGAG |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q8VIG2 |
Definition |
sp|Q8VIG2|LKAP_RAT Limkain-b1 OS=Rattus norvegicus |
Align length |
29 |
Score (bit) |
30.8 |
E-value |
2.2 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
B8M344 |
Definition |
tr|B8M344|B8M344_9EURO GPI-anchored cell surface glycoprotein, putative OS=Talaromyces stipitatus ATCC 10500 |
Align length |
43 |
Score (bit) |
33.1 |
E-value |
7.1 |
Report |
|