| BP920567 | |
| Clone id | YMU001_000138_F06 |
| Library | YMU01 |
| Length | 109 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000138_F06. |
| Accession | BP920567 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2701Contig1 |
| Sequence | TGAAGAACCCAAATCGATTTCCAAATAGCCAGTGCGTTTTCCACTTTCCGGAGCCCAGTA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q7XUR3 |
| Definition | sp|Q7XUR3|FUCO1_ORYSJ Putative alpha-L-fucosidase 1 OS=Oryza sativa subsp. japonica |
| Align length | 33 |
| Score (bit) | 30.8 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q8XJ85 |
| Definition | tr|Q8XJ85|Q8XJ85_CLOPE Putative uncharacterized protein CPE1876 OS=Clostridium perfringens |
| Align length | 33 |
| Score (bit) | 42.7 |
| E-value | 0.009 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |