BP920599 |
Clone id |
YMU001_000139_A12 |
Library |
YMU01 |
Length |
137 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000139_A12. |
Accession |
BP920599 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
CL84Contig2 |
Sequence |
TCCTTGCACTTCTGCGCCACATCCTGAGCAGCAAGCATGGCTGCGTACGGAGAAGACTCG TCTCTGTCAGCTTTCACCTTCATGCCACCAGTAACTCGAGCAAGCGTCTCCTTGCCAGAC AGATCTGTGACATGCAC |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
P46295 |
Definition |
sp|P46295|RS14_CHLRE 40S ribosomal protein S14 OS=Chlamydomonas reinhardtii |
Align length |
45 |
Score (bit) |
88.2 |
E-value |
1.0e-17 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
B8LN86 |
Definition |
tr|B8LN86|B8LN86_PICSI Putative uncharacterized protein OS=Picea sitchensis |
Align length |
45 |
Score (bit) |
89.4 |
E-value |
8.0e-17 |
Report |
|