BP920613 | |
Clone id | YMU001_000139_C07 |
Library | YMU01 |
Length | 170 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000139_C07. |
Accession | BP920613 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | ATCACATCATTTACTTCTGAAAGGAAATTGAATACGAGCCAGTATTCGGATCTTGGACAG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q91Z38 |
Definition | sp|Q91Z38|TTC1_MOUSE Tetratricopeptide repeat protein 1 OS=Mus musculus |
Align length | 49 |
Score (bit) | 67.4 |
E-value | 2.0e-11 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q8W378 |
Definition | tr|Q8W378|Q8W378_ORYSA Putative tetratricopeptide repeat protein OS=Oryza sativa |
Align length | 52 |
Score (bit) | 92.8 |
E-value | 7.0e-18 |
Report | BLASTX 2.2.19 [Nov-02-2008] |