BP920711 | |
Clone id | YMU001_000140_E08 |
Library | YMU01 |
Length | 565 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000140_E08. |
Accession | BP920711 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL4100Contig1 |
Sequence | TCTTTACTAAACTTTGAGAAATAAAGATTCAGGGTTGATCACAAGAAGTGTTCTTTACAT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9WV70 |
Definition | sp|Q9WV70|NOC2L_MOUSE Nucleolar complex protein 2 homolog OS=Mus musculus |
Align length | 101 |
Score (bit) | 30.8 |
E-value | 4.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B4FS59 |
Definition | tr|B4FS59|B4FS59_MAIZE Putative uncharacterized protein OS=Zea mays |
Align length | 70 |
Score (bit) | 81.3 |
E-value | 3.0e-14 |
Report | BLASTX 2.2.19 [Nov-02-2008] |