| BP920917 | |
| Clone id | YMU001_000143_D02 |
| Library | YMU01 |
| Length | 490 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000143_D02. |
| Accession | BP920917 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | CGAAGACACAGTGGTAGAACAAGGTGGAGAGGTGGTGATTGCAGCCAAAGGCACTCGGGG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5XI50 |
| Definition | sp|Q5XI50|MARH7_RAT E3 ubiquitin-protein ligase MARCH7 OS=Rattus norvegicus |
| Align length | 54 |
| Score (bit) | 30.4 |
| E-value | 4.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RKS9 |
| Definition | tr|A9RKS9|A9RKS9_PHYPA Predicted protein (Fragment) OS=Physcomitrella patens subsp. patens |
| Align length | 66 |
| Score (bit) | 101.0 |
| E-value | 2.0e-20 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |