BP920917 | |
Clone id | YMU001_000143_D02 |
Library | YMU01 |
Length | 490 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000143_D02. |
Accession | BP920917 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CGAAGACACAGTGGTAGAACAAGGTGGAGAGGTGGTGATTGCAGCCAAAGGCACTCGGGG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5XI50 |
Definition | sp|Q5XI50|MARH7_RAT E3 ubiquitin-protein ligase MARCH7 OS=Rattus norvegicus |
Align length | 54 |
Score (bit) | 30.4 |
E-value | 4.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RKS9 |
Definition | tr|A9RKS9|A9RKS9_PHYPA Predicted protein (Fragment) OS=Physcomitrella patens subsp. patens |
Align length | 66 |
Score (bit) | 101.0 |
E-value | 2.0e-20 |
Report | BLASTX 2.2.19 [Nov-02-2008] |