BP921106 | |
Clone id | YMU001_000145_F11 |
Library | YMU01 |
Length | 140 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000145_F11. |
Accession | BP921106 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL551Contig1 |
Sequence | CACAGCTATCTCTCCTTGTAATGAATCCACAATGTTCCCACGCTCGATCAGAAACTCCCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9TLI4 |
Definition | tr|A9TLI4|A9TLI4_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 45 |
Score (bit) | 53.5 |
E-value | 5.0e-06 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |