| BP921106 | |
| Clone id | YMU001_000145_F11 |
| Library | YMU01 |
| Length | 140 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000145_F11. |
| Accession | BP921106 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL551Contig1 |
| Sequence | CACAGCTATCTCTCCTTGTAATGAATCCACAATGTTCCCACGCTCGATCAGAAACTCCCT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9TLI4 |
| Definition | tr|A9TLI4|A9TLI4_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 45 |
| Score (bit) | 53.5 |
| E-value | 5.0e-06 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |