BP921174
Clone id YMU001_000146_E12
Library
Length 339
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000146_E12.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
CAGAGACGGATAACAATCTCTCTTTTAAGGGAGAGCTTAGACATTAGTCATTAGAAATGG
CCTTCAGAATCTCAGCACCTGCACCAGCTACCAAGTAAACATAGAAGGATGACGGTTTTG
GTTACATCAACCCTTGTAAGTTCTGGAGCTAGACTGAGTTTGATTACAACATAAAAAGAC
TTCACATTTCAACTTTGGACGATGGTGGATTTTATCATCTTTAGAAAACCATTACCGCTT
TCGTGTTATAAATGCTTAAGAACATCACATCTCCAGCGCTGCTGCCTCTGGCGCCTCATC
TAGCTAAGCAATTCTGAACTCAAAAGGTGTGTACTCTCC
■■Homology search results ■■ -
sp_hit_id P30437
Definition sp|P30437|CP17A_ONCMY Cytochrome P450 17A1 OS=Oncorhynchus mykiss
Align length 27
Score (bit) 29.3
E-value 6.4
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP921174|Adiantum capillus-veneris mRNA, clone:
YMU001_000146_E12.
(339 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|P30437|CP17A_ONCMY Cytochrome P450 17A1 OS=Oncorhynchus mykis... 29 6.4

>sp|P30437|CP17A_ONCMY Cytochrome P450 17A1 OS=Oncorhynchus mykiss
GN=cyp17a1 PE=2 SV=1
Length = 514

Score = 29.3 bits (64), Expect = 6.4
Identities = 15/27 (55%), Positives = 17/27 (62%)
Frame = -2

Query: 158 LSLAPELTRVDVTKTVILLCLLGSWCR 78
L L+PELTR VT V LC S+CR
Sbjct: 171 LDLSPELTRA-VTNVVCSLCFSSSYCR 196


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP921174|Adiantum capillus-veneris mRNA, clone:
YMU001_000146_E12.
(339 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******