BP921187 [AcEST]

BP921187
Clone id	YMU001_000146_G02
Library	YMU01
Length	274
Definition	Adiantum capillus-veneris mRNA. clone: YMU001_000146_G02.
Accession	BP921187
Tissue type	prothallium
Developmental stage	-
Contig ID	CL2424Contig1
Sequence	AACTCAACATGATACTCACACCCTGCATAATAATCAGTATGTTTATATCAATCACACTCA GCTACTACTGCATAGTGCATGAGGAAGGAGACAAAAAGTTAGGTCTTGCACTAACTCAAG CCCGAAAACGTCTCACACCAAGTCCTAATATCAGAATTCAAAGCCTGCCTTTTGCATTTA GTTTAGTACACAGCAAATATAACAGGTCTAGACCCTCATGCAGTGCGGAAGGAGCTTTCA CGGCTCTCATCCGCTGAAGAGCACGACACTGACT
■■Homology search results ■■	-
Swiss-Prot (release 56.9)	Link to BlastX Result : Swiss-Prot
sp_hit_id	Q96RI9
Definition	sp\|Q96RI9\|TAAR9_HUMAN Trace amine-associated receptor 9 OS=Homo sapiens
Align length	34
Score (bit)	29.3
E-value	6.4
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= BP921187\|Adiantum capillus-veneris mRNA, clone: YMU001_000146_G02. (274 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value sp\|Q96RI9\|TAAR9_HUMAN Trace amine-associated receptor 9 OS=Homo ... 29 6.4 sp\|Q67S76\|LEPA_SYMTH GTP-binding protein lepA OS=Symbiobacterium... 29 6.4 >sp\|Q96RI9\|TAAR9_HUMAN Trace amine-associated receptor 9 OS=Homo sapiens GN=TAAR9 PE=2 SV=1 Length = 348 Score = 29.3 bits (64), Expect = 6.4 Identities = 15/34 (44%), Positives = 23/34 (67%), Gaps = 3/34 (8%) Frame = +3 Query: 24 CIIISMFISITLS---YYCIVHEEGDKKLGLALT 116 CI++S F S+T S +Y +EEG ++L +ALT Sbjct: 152 CIVLSWFFSVTYSFSIFYTGANEEGIEELVVALT 185 >sp\|Q67S76\|LEPA_SYMTH GTP-binding protein lepA OS=Symbiobacterium thermophilum GN=lepA PE=3 SV=1 Length = 603 Score = 29.3 bits (64), Expect = 6.4 Identities = 13/24 (54%), Positives = 16/24 (66%) Frame = +3 Query: 69 CIVHEEGDKKLGLALTQARKRLTP 140 CIVH E +KLG AL Q ++L P Sbjct: 501 CIVHREKAQKLGRALVQKLRKLIP 524
TrEMBL (release 39.9)	Link to BlastX Result : TrEMBL
tr_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= BP921187\|Adiantum capillus-veneris mRNA, clone: YMU001_000146_G02. (274 letters) Database: uniprot_trembl.fasta 7,341,751 sequences; 2,391,615,440 total letters Searching..................................................done *** No hits found ****