BP921314 [AcEST]

BP921314
Clone id	YMU001_000148_D01
Library	YMU01
Length	133
Definition	Adiantum capillus-veneris mRNA. clone: YMU001_000148_D01.
Accession	BP921314
Tissue type	prothallium
Developmental stage	-
Contig ID	CL1565Contig1
Sequence	GAGCAGGGTTCCTCACTTCCAGGTGCTAGTTCTAGTCGAGCTGGTATGCCGTTTGCAGCA ATCCGTCCTGAACCAGTGGCTTTGTCTGGCTTGTCAAGGCAGCCTGTCGACATTCGAAGA AGACGGTGACCTG
■■Homology search results ■■	-
Swiss-Prot (release 56.9)	Link to BlastX Result : Swiss-Prot
sp_hit_id	P17381
Definition	sp\|P17381\|VP9_RDV Non-structural protein Pns9 OS=Rice dwarf virus
Align length	22
Score (bit)	29.6
E-value	4.9
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= BP921314\|Adiantum capillus-veneris mRNA, clone: YMU001_000148_D01. (133 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value sp\|P17381\|VP9_RDV Non-structural protein Pns9 OS=Rice dwarf viru... 30 4.9 sp\|Q85446\|VP9_RDVO Non-structural protein Pns9 OS=Rice dwarf vir... 29 8.3 >sp\|P17381\|VP9_RDV Non-structural protein Pns9 OS=Rice dwarf virus GN=S9 PE=3 SV=1 Length = 351 Score = 29.6 bits (65), Expect = 4.9 Identities = 13/22 (59%), Positives = 15/22 (68%) Frame = -3 Query: 95 DKPDKATGSGRIAANGIPARLE 30 D P KA SG ++A GIPA LE Sbjct: 295 DAPPKAVSSGNVSARGIPAFLE 316 >sp\|Q85446\|VP9_RDVO Non-structural protein Pns9 OS=Rice dwarf virus (isolate O) GN=S9 PE=3 SV=1 Length = 351 Score = 28.9 bits (63), Expect = 8.3 Identities = 13/22 (59%), Positives = 15/22 (68%) Frame = -3 Query: 95 DKPDKATGSGRIAANGIPARLE 30 D P KA SG ++A GIPA LE Sbjct: 295 DAPPKAVPSGNVSARGIPAFLE 316
TrEMBL (release 39.9)	Link to BlastX Result : TrEMBL
tr_hit_id	-
Definition	No hits.
Align length	-
Score (bit)	-
E-value	-
Report	BLASTX 2.2.19 [Nov-02-2008] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= BP921314\|Adiantum capillus-veneris mRNA, clone: YMU001_000148_D01. (133 letters) Database: uniprot_trembl.fasta 7,341,751 sequences; 2,391,615,440 total letters Searching..................................................done *** No hits found ****