BP921630 | |
Clone id | YMU001_000152_C11 |
Library | YMU01 |
Length | 528 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000152_C11. |
Accession | BP921630 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CACGCAAAACGAAATTTAAGTTCAAGCTCCAAGAGTTCAACCAACACGAATCTACAACAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q8XNF5 |
Definition | tr|Q8XNF5|Q8XNF5_CLOPE Probable myosin-crossreactive antigen OS=Clostridium perfringens |
Align length | 25 |
Score (bit) | 33.5 |
E-value | 6.7 |
Report | BLASTX 2.2.19 [Nov-02-2008] |