| BP921718 | |
| Clone id | YMU001_000153_C11 |
| Library | YMU01 |
| Length | 493 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000153_C11. |
| Accession | BP921718 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2591Contig1 |
| Sequence | CTTCTCCTTTCTTTTGATCCTTTCATTAACACGCTTTCCCATTTCCTCTGGATCTTCAAA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q2MI42 |
| Definition | sp|Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 OS=Solanum lycopersicum |
| Align length | 38 |
| Score (bit) | 30.0 |
| E-value | 5.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RLA1 |
| Definition | tr|A9RLA1|A9RLA1_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 56 |
| Score (bit) | 48.5 |
| E-value | 0.0002 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |