BP921718 | |
Clone id | YMU001_000153_C11 |
Library | YMU01 |
Length | 493 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000153_C11. |
Accession | BP921718 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2591Contig1 |
Sequence | CTTCTCCTTTCTTTTGATCCTTTCATTAACACGCTTTCCCATTTCCTCTGGATCTTCAAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q2MI42 |
Definition | sp|Q2MI42|YCF1_SOLLC Putative membrane protein ycf1 OS=Solanum lycopersicum |
Align length | 38 |
Score (bit) | 30.0 |
E-value | 5.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RLA1 |
Definition | tr|A9RLA1|A9RLA1_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 56 |
Score (bit) | 48.5 |
E-value | 0.0002 |
Report | BLASTX 2.2.19 [Nov-02-2008] |