BP921785 | |
Clone id | YMU001_000154_B05 |
Library | YMU01 |
Length | 416 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000154_B05. |
Accession | BP921785 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GGGTGAAATAGCTCACCATACGTTGCAGGTTGACGTCATATACAACATACATGATATGGT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q86SQ0 |
Definition | sp|Q86SQ0|PHLB2_HUMAN Pleckstrin homology-like domain family B member 2 OS=Homo sapiens |
Align length | 60 |
Score (bit) | 30.0 |
E-value | 3.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |