DK943662
Clone id YMU02A01NGRL0003_I18
Library
Length 297
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0003_I18. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID -
Sequence
GGGAGCTGCAGGTGGAGTTTTTGTGTTGCGTGTCCAATTGACATGATGATGTCAATGAAT
CATTCATAAGCTGCATCAGCTGAAAACAGAACATGTACACTAAGTTATATAATAGGTCAC
AGACAACTGTTGTATAAATTATTGGAAGGATTGGCTCCTTGTATCTCTATCTGGGCTAGC
ATTATAGCTTGCTCTGTATCTTGGCTCAAAGTCTAGACACATGAACACACAATTGAATAA
CAGTGTTCATTCGGAACATCTGGAAAACNAAAAAAAAAAAAAAAAAAAAAAAAAAAA
■■Homology search results ■■ -
sp_hit_id Q16HH9
Definition sp|Q16HH9|MED23_AEDAE Mediator of RNA polymerase II transcription subunit 23 OS=Aedes aegypti
Align length 29
Score (bit) 30.8
E-value 2.2
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK943662|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0003_I18, 5'
(263 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q16HH9|MED23_AEDAE Mediator of RNA polymerase II transcriptio... 31 2.2

>sp|Q16HH9|MED23_AEDAE Mediator of RNA polymerase II transcription
subunit 23 OS=Aedes aegypti GN=MED23 PE=3 SV=1
Length = 1409

Score = 30.8 bits (68), Expect = 2.2
Identities = 12/29 (41%), Positives = 19/29 (65%)
Frame = -2

Query: 157 EPILPIIYTTVVCDLLYNLVYMFCFQLMQ 71
+P L + Y +CDLLY++ YMF +M+
Sbjct: 1293 QPSLALKYMDPICDLLYHIKYMFIGDMMK 1321


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK943662|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0003_I18, 5'
(263 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******