DK943708
Clone id YMU02A01NGRL0003_L02
Library
Length 124
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0003_L02. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID -
Sequence
GCAACATTCTTGAGCTTGTGATATGGAAAAGTGAAAATAAAAAGTGTGCAAGGTTACTCG
TTATCTTGGTTTTGCTTGGAAGGAATATTTGCTTGNNAAANAAAAAAAAAAAAAAAAAAA
AAAA
■■Homology search results ■■ -
sp_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -
tr_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -