DK943931
Clone id YMU02A01NGRL0004_G23
Library
Length 128
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0004_G23. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID -
Sequence
CGTCTCTTCCTTTGGGGCCCGGGCCCAGTTTTTAAGTGAATTTGTTTGTAGCTGTTTCCC
AGGAGATCCTGGTCCTGACTAGTGCTTGTATTCTCACAGATAAAGAACGCCCGGCGGCGC
CTCGATCC
■■Homology search results ■■ -
sp_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -
tr_hit_id -
Definition -
Align length -
Score (bit) -
E-value -
Report -