| DK948481 |
| Clone id |
TST38A01NGRL0003_G22 |
| Library |
TST38 |
| Length |
136 |
| Definition |
Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0003_G22. 5' end sequence. |
| Accession |
DK948481 |
| Tissue type |
prothallia |
| Developmental stage |
gametophyte |
| Contig ID |
CL638Contig1 |
| Sequence |
GAATTGATTGCCATTTTGCGCAGCATTGAAATCTACAAACACAACACTGAACAGCGGATT GCTCGCACCTGGGGCACCACTGCACCTGGTTTACCTTATGTCTAGGAAGCGCTTACCAGT TCTGGAAACTGGCTGG |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
O95340 |
| Definition |
sp|O95340|PAPS2_HUMAN Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthetase 2 OS=Homo sapiens |
| Align length |
43 |
| Score (bit) |
44.3 |
| E-value |
0.0002 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
Q1HL02 |
| Definition |
tr|Q1HL02|Q1HL02_CAMSI ATP sulfurylase (Fragment) OS=Camellia sinensis |
| Align length |
45 |
| Score (bit) |
79.3 |
| E-value |
9.0e-14 |
| Report |
 |