DK948481 |
Clone id |
TST38A01NGRL0003_G22 |
Library |
TST38 |
Length |
136 |
Definition |
Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0003_G22. 5' end sequence. |
Accession |
DK948481 |
Tissue type |
prothallia |
Developmental stage |
gametophyte |
Contig ID |
CL638Contig1 |
Sequence |
GAATTGATTGCCATTTTGCGCAGCATTGAAATCTACAAACACAACACTGAACAGCGGATT GCTCGCACCTGGGGCACCACTGCACCTGGTTTACCTTATGTCTAGGAAGCGCTTACCAGT TCTGGAAACTGGCTGG |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
O95340 |
Definition |
sp|O95340|PAPS2_HUMAN Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthetase 2 OS=Homo sapiens |
Align length |
43 |
Score (bit) |
44.3 |
E-value |
0.0002 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
Q1HL02 |
Definition |
tr|Q1HL02|Q1HL02_CAMSI ATP sulfurylase (Fragment) OS=Camellia sinensis |
Align length |
45 |
Score (bit) |
79.3 |
E-value |
9.0e-14 |
Report |
|