| DK951044 | |
| Clone id | TST38A01NGRL0010_F11 |
| Library | TST38 |
| Length | 636 |
| Definition | Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0010_F11. 5' end sequence. |
| Accession | DK951044 |
| Tissue type | prothallia |
| Developmental stage | gametophyte |
| Contig ID | CL1618Contig1 |
| Sequence | ATCCAGTTCAAAGAGTTCTGCACACGGGTCTTCCGCAACTTTAGCCTTGAAACCACCCGG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9NNS3 |
| Definition | tr|A9NNS3|A9NNS3_PICSI Putative uncharacterized protein OS=Picea sitchensis |
| Align length | 154 |
| Score (bit) | 135.0 |
| E-value | 2.0e-30 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |