DK951044 | |
Clone id | TST38A01NGRL0010_F11 |
Library | TST38 |
Length | 636 |
Definition | Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0010_F11. 5' end sequence. |
Accession | DK951044 |
Tissue type | prothallia |
Developmental stage | gametophyte |
Contig ID | CL1618Contig1 |
Sequence | ATCCAGTTCAAAGAGTTCTGCACACGGGTCTTCCGCAACTTTAGCCTTGAAACCACCCGG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9NNS3 |
Definition | tr|A9NNS3|A9NNS3_PICSI Putative uncharacterized protein OS=Picea sitchensis |
Align length | 154 |
Score (bit) | 135.0 |
E-value | 2.0e-30 |
Report | BLASTX 2.2.19 [Nov-02-2008] |