DK957536 | |
Clone id | TST39A01NGRL0028_K02 |
Library | TST39 |
Length | 663 |
Definition | Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0028_K02. 5' end sequence. |
Accession | DK957536 |
Tissue type | prothallia with plantlets |
Developmental stage | gametophytes with sporophytes |
Contig ID | CL2325Contig1 |
Sequence | GATGATGCAAGCCTGGTTAAGCTTGAAGTCATGCCCGAACAGGAAGGTTGATTGATTTGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q6NRV8 |
Definition | sp|Q6NRV8|R111B_XENLA E3 ubiquitin-protein ligase arkadia-B OS=Xenopus laevis |
Align length | 63 |
Score (bit) | 31.2 |
E-value | 5.1 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |