DK959577 | |
Clone id | TST39A01NGRL0005_B06 |
Library | TST39 |
Length | 635 |
Definition | Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0005_B06. 5' end sequence. |
Accession | DK959577 |
Tissue type | prothallia with plantlets |
Developmental stage | gametophytes with sporophytes |
Contig ID | CL1205Contig1 |
Sequence | CCCTATCTACCTCCTTCTACTTTTAGTCCTGCTCGTGCAGCTTCCTCACCTTCGAAGTCC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q38M44 |
Definition | tr|Q38M44|Q38M44_SOLTU Putative uncharacterized protein OS=Solanum tuberosum |
Align length | 22 |
Score (bit) | 42.4 |
E-value | 0.024 |
Report | BLASTX 2.2.19 [Nov-02-2008] |