| DK959577 | |
| Clone id | TST39A01NGRL0005_B06 |
| Library | TST39 |
| Length | 635 |
| Definition | Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0005_B06. 5' end sequence. |
| Accession | DK959577 |
| Tissue type | prothallia with plantlets |
| Developmental stage | gametophytes with sporophytes |
| Contig ID | CL1205Contig1 |
| Sequence | CCCTATCTACCTCCTTCTACTTTTAGTCCTGCTCGTGCAGCTTCCTCACCTTCGAAGTCC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q38M44 |
| Definition | tr|Q38M44|Q38M44_SOLTU Putative uncharacterized protein OS=Solanum tuberosum |
| Align length | 22 |
| Score (bit) | 42.4 |
| E-value | 0.024 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |