DK963093 |
Clone id |
TST39A01NGRL0015_J18 |
Library |
TST39 |
Length |
102 |
Definition |
Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0015_J18. 5' end sequence. |
Accession |
DK963093 |
Tissue type |
prothallia with plantlets |
Developmental stage |
gametophytes with sporophytes |
Contig ID |
CL62Contig1 |
Sequence |
AAATAGCTTCCCTTGAATGTGTAGCTCTAAACTAGCAATGAAATCGTTCTCTGCTGCTCT GATCTTACTGGCCCTATGTCTGTCTTCGGCCTCTGCTCTTCC |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|