CL1128Contig1
Contig ID CL1128Contig1
Length 991
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1128contig1 sequence.
Clone ID BP917093 BP915263 DK958352
Sequence
TTTTGAGATGATATGCCACAACCAAAAGAGCTCACTGCTTCCTCAAGTTGGATCTGTGTT
AAGCTAACAACCTCATGAGATGATCTTTGCACACCCCATGCAGCATTGATAGTAGGAGTG
CTATCGTTGGAGTATCCATGCAAAAATACTTGTGTATCAGCATGTGCTCCAACTGCCACT
GACTGATATTGTGAAGCCTTGGAGACCTTCGGCTCATCTGCAGCAGCGCCTGATACCACG
GTCGAATTAGGAATAACACCAGGCTGCTGCAGGTTCGAGCCAATCACAGATGTCAGGTAC
TTCCCAACCCTTCCATCATTTTTACCCACATCTGCATTTGGTACAGACCACCTTCCTGCA
GGATTCTGTCCTGATGAAAGCATCGATTCCTTTCCAAACACTTTTTGCTGCTTGGTCACA
ATCTGCTCCTTTACCTTAAGTTCCTCTATCTTAGCTTTGTCACGCATCTCGCGCTGTTCT
CGAAGTAGATTGCGCTTTGACCTAACCTCAGTGAAGTCATCTTTATCATTGTACACTCCA
CTTCCTTGCTGCTCAAAATCAAAATCTGCACCACCTTGCGAAGCGGTATCCCCAAGCTCA
TCCAATTTTAGCTTTGTTAACTTTCCTTTGGCCTGATGGCTTGCACTTCTTATCCTTGCT
TGACCAGCATCAACTTGAGTGGTTTTAAACCCAGCCTGCACTGCTTGCAACCTAGGAGCA
GACTTAGTAAGTTGGGACCTTGTTCCTCCAAAGCTTTGTGAGTAAAAACTCGAGTCCGAT
GTGTCATCAGTTGCAGACCTTGATGCGCCGTCAAGCCCACAAACTGAGTCATTATGTTTA
TTATCATAGGGGACGTCATGAACTTCTTCATCGAGACCCAGCTCGGACCCCTTCTCCGAA
GTCACTGATAGCTTGCGAATTTTGTATTCAGCACGACAGATATTTTGGCGATTTGTTCTA
TTTCGAGGGGCTTCTTTGCCTGGACTTTCAG