CL1172Contig1
Contig ID CL1172Contig1
Length 830
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1172contig1 sequence.
Clone ID BP914045 BP919822 BP919896
Sequence
TTCTGGGGGTTCGTATCCACTAAAGCAGCCTATCTATGCCGCTGTATTCATAGATTTGTC
AATGCTGCAACTATAGAAACTTTCATGAATATTAATACCCAATGCAAAACAAAAAACACA
ACTTAGGTTTCTTTTCAGTGTTAGTGTAAGAAGTAAACTTTGTGTTTAAGGTCGCAAAGC
CAAATAGTAAAGTAGACCCTGTGGTTAAGGTTTACAACGCGTTGTAAACGAGTTGGGGAA
GGGCAAGGCCCATACCTTGTCATGAACCTCCCCACCAATAGATAGAGACAAATAGAAATA
ACCAAACCACGTCCACAAAATACCAGTACCGAGCAGCTGCTTCGAAGCCAAAGTGATGTA
AAGGACTGAAATGGCCCATATATTAACGAATACCGCGTATCATCAAGAGAATAGTTCCTA
TAATGACATAGAACCCATAAAACCCAGTAGCTAAAAAAGAAGTAAACCCATAAATACCGT
CAGAGATGATAAAAAGTGCTTCATAATATTCCATTCCTTAAAACCCAGTGAAAACTAAAG
CCAGCCAAACGATAGCTACTAAAGCATGAACTGCTTATTATTTTAAACCTGCGAGTATGG
CATAATGAGCCCAAGTCACAGCAGCTCCAGAGAGAAGGAGAATAAGGGTATTTAGAAAAG
GGATTCCCTAAGGATTTAAAACTTCAATTCCTTTAGGGGGCCAAATAGCTCCAATCTCTA
CTGCAGGTGCCGAAGAGGAATGAAAAAAGGCCCAAAAAAAGGCTAAAGAAAACATAACCT
CCGATACGATAAACAAAAGAAAACCGTAACGAAGCCCTAATTATACCACT