CL1188Contig1
Contig ID CL1188Contig1
Length 644
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1188contig1 sequence.
Clone ID DK948342 BP913253
Sequence
AAAGATACCACTGCCATTGAGGACAAAGAGCTTCGCAGAACTCTTCAGTCATTGGCTTGT
GGAAAAGTGAGAGTGCTCCTCAAGGAACCCAAAGGTAGAGATGTGGACGACGATGATAGC
TTTTCTTTCAATGGGGACTTTGTTGCACCGCTGTTTCGAATCAAAGTAAATGCAATTCAG
CTAAAAGAGACTGTGGAGGAAAATACAAGCACCACTGAAAGGGTTTTTCAGGATAGGCAA
TATCAGATAGATGCTGCTATTGTGAGAATCATGAAGACGAGAAAAGTTCTTAGCCATACC
CTGTTAATAACTGAGCTTTTTCAACAGCTTAAATTCCCCATTAAGCCAGCAGATTTGAAG
AAAAGAATAGAGAGTTTGATTGATAGAGAGTACTTGGAGAGGGACAAAAGCAATCCCCAG
ATATACAATTACCTTGCTTGACCAGCAGAGAACAGATTAGTGTTACTCTTAAATTGTGCA
AATTTCCTGCTATGTAATCCAATGAAATGCAACACTTCAGGCTTTGAGTATGGCACGTGC
TTGCAACGAAGGCCCCTGTGTGTCGAAGTATGTCCACCGATAGTGCGGTGCTGAAAGCAA
GCATTATTCTTTAGTTTTAAAGCAAGCATATTTTATAGTTCTGC