CL1231Contig1
Contig ID CL1231Contig1
Length 570
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1231contig1 sequence.
Clone ID BP911649 BP919703 BP920068
Sequence
TTTGTTACATTCGCCAGGTCATAATATGAAAGCACCGTTACCAACCGCAGGAAACAGTTT
TTGTGGCTTGGGGTTTCAGCATATTTTATTTCTGTGTGATACTTTTCGATTGGCTGCAGT
AAATGCTAACATTGCAGGCTTTCAAGATAAATAAAACTTCAGGATCCTTTCCATGCTCGA
ATGGATCTCATTTCACAACATTAGAACCCAGCTTGCTTCTTCTTCAAGAGCCTGTAAGTC
CCAAATTTATTTGCAGATTGCCAAGACCACGGGAAAAAGAAAGCACGTTGAATGGCTGGT
GATCTCTCGTTGTCTAGAAAAGGAAGCTCCACAATCACCTCCCACAAGGTTCTGTTACTC
CCTCTAAGTTGCATTCCTTCACGATGCAGATCCAACTCCAGTAAATAATTGCACGCATCT
TCATTTGTCATAAACTGCTCAACAGAAGCCTTATTAAGTTTGTTGAAATAAGGAGGGGCT
GCTGCAGTTCCACCAATAGAGGCATTGAAAGGCATTGGTAAAAGCCCATTAAAGCCATCA
TCAAGCCATCCGACTTTGTATGAAGGGGAT