CL1261Contig1
Contig ID CL1261Contig1
Length 823
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1261contig1 sequence.
Clone ID DK950594 BP916015 DK955497
Sequence
GAGAGAAAAGATGTCTTTTTACAAGCCAGTGCTGTAGGAGGAAGTACATTTCGTTACAAA
CTGCAACTCTACATTGGCTTGAATTAGCTAGAGGGCCCCTGTCACACCAGCTGGAAAACC
CAAAAGAACTTCTAACCAACACGCAAGTCTGTAGATGTATACTATTCACAAAAGATACAC
TACTCTAAGATGCCTCTGAATTTTCAAGTTGATGGCATCAAGGCTGCCATGGCACCACGC
CGCTCTCCAGCAGCGACAAGCTTCTCAACTCGGGCAACAATATGTTTTCCGTAAGTGTAT
TTTTTAAGTGCGTGCAAATGAACACGAATGCGGGAAAGCAGCATTTCTCTTTGCTGATCA
TCACATGTTTCCAAGACTTTCTGAACCACATAATTAGCAAATTGGTCCTTCATCATAGCC
TGCAGGGGTTCGTTTTCATCTGTCTGCCCAAGCATCTCTGTGATCAAAATTTGACGCTCT
GCAGGACCACTAAACTCCAAGCACTTCTCCACAACATTGGATGCAAATTTGTGCTGGCTC
ATTTGTACAATCTGGCCAGCCATCTTTGTCAAAATCTCACTCCGTTCCTCCGGTTTACCA
TGCTCCAAAATGTGCTGTACAACATAGTTGCCATATTGATCTTGTGCCAGGATGCAAACA
GAGCGTAAAATCTCCTCCATTATGCCACTTTGTTTCTGATCTTCAGTGCAATGCTCAAGC
ACCCGCTGAATTACTCTACAACCATATGGATGGGTAGACAGCATGACGACTTGTCCATGA
AAAGCAGACAAGATAAAGTTTATGTGTTCAGGGGGAACACACT