CL1378Contig1
Contig ID CL1378Contig1
Length 798
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1378contig1 sequence.
Clone ID BP915393 BP921245 BP921450
Sequence
TCAGACTGTTATGAGTCACAATATCTGGCTGACAGCCTTTTTCTTTCATCTGAGAGAAGA
GTTTTAATGCTTCGTCTAGCTTTTTGTGTCGGCAACAATGACTAATGAGGGCATTGTAAA
TATTAACATTTGGATCCAGACCTGCTGCCTGCATGTTTTCCAAAGCTTATAAAGCCTCTT
CTGTCCTCTGTGCGCTGCACAAGCATTTCACAAGCCAGTCATATGTCCTCACATTTGCAT
GACAACCTTTCTCCTCCATCACTTGTAGTAGCTTTAAAGCAGAGTCTGCTTTTCCAGCTC
TAGCGAATGCTGCAATGGCACCATTGAATTCTCCAACATCTGAAAGATTCTGCAGAACAC
TGGCAACACCCTCATCATCATTGGCCTTGATGTGTCCAGAGAGGGCAGCAGCATACAGAT
TCGCATCTGGATTTAAGCCAAAAAACCTCATCTTATCCATGACTTCCTTTGCTTCTGTCA
TCCTGCCAGCTTTGCCACTATAATAGACTACTGCCGCAAAATCATTGGGGAGGACTTTCA
CATCTTTTTGCCACATTTCCTCAAGACATTCCATGGAAATGTCAAACATACCAGCATCTA
AAAAGCGTCTGATGAGGGCTCTGTATTCATGTCTTCCATGTGAATAACCTTTTTGTTTCC
CCGCCCACGTAAAGAAATCTTTAAGATTAGCTACTTCCATCTTTTGCAGCACCTTCTTTA
CCACTTTATCTGTGAGGTCTTTGGAGAATCCAGACAAAGCTTCTTCAATATCAGCATTCC
ACAATTTTCCCTCACAAA