CL1457Contig1
Contig ID CL1457Contig1
Length 684
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1457contig1 sequence.
Clone ID BP914669 BP917971 BP919583
Sequence
GAGGCAATGGCGCACGGCGGGTATGGCAAACGCAGAGTTGCGGGGAGGCCCCCTCTCTCT
GCCCACGCAGGAAATAGCAGTAGAAGCCTCGGTGTTCGCCATCACAAAGATAGCGATAAG
AAGGCCAAGATTGTATCTATCAAGAACCAGATCCGTTCTGTTGAACGGCTTCTCAGAAAG
GCTCTTCCTTTGGAGATTAAAGATGCCCAGCAAAGGAGACTGGAGGATTTAAAGAGACAA
GCAGAGTTACATTCACATGCTGAACTTGAAAGAAAGATGGCACTCCGATACCGCAAAGTC
AAGTTCTTTGAAAGGAGAAAGATTGAAAGAGCTATTAGGAGACTTGAGAGATTTCAAAGA
GCAGCAGCTGATAATCCAGCTGAAGATTCCACCCGACAGGCTGCAGATATGGCACAGAAA
CTTGGACAACTTAAGGAAGACCTGGAGTATGTACGATTCTTTCCAAAAACCGAGAAGTAT
GTTTCTTTGTTCACGGGTGGTGATGATCAGGTTATAGTTGATCAAAGAAATAAATTGAGG
GACCAAATAAAGGCCAATCTTGCTGCTGCTGCAGCTGCTGGAGTGGAGCCAGAAGAAACG
GGAAGTGAGGATGATGGAGCGACAGATTTGAGCGAGGATGAGTTCTTCTCGGCTGGGAGT
TCAAGTGATGATGCTGATGCAGAT