CL1511Contig1
Contig ID CL1511Contig1
Length 755
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1511contig1 sequence.
Clone ID DK945316 DK954929 DK958594
Sequence
ATTCGCAGTTTAGCATGAGGGGGAAGAGCTAGCTAGGATGGAGGAATGGCCAGACCCCTT
TCCCCCAGAGTCTCCCGCCACCCCCTCTCTGCGATTGCAACTCTTCTGGCGACATTACCC
TCATCATCACCACTATGGCACCCACCTCCTTCAACAACATTGCTATGGGCCTCTTCATGG
CCTGTTCGGCGTCTCTCTGCTGCTTCCTTTGCAGACGAGTTCATCGCCGTAGCTCAGGGG
GTGAGAAGAGTCGGCTTCTTGTCTGTTTGGCCAAATTATAGGTCACGCGTTGTCCACAGC
CATAGCCGCAAGCTTCTTGCCATCATGCATCAGCGAAGCTGGGATGCTGCCGTCGAGGAC
GATCTTGCAAATTCAGGCATCCCTCTGAGACCCAACATTGTGGATCAAGTCATTACATGC
ATCCCGAGCCCAAAGCTCGCTCTGCAGTTCTTTATATGGGCCGGTGAGCAAATTGGGTAT
CCTCCCCTGACCTCCACCACAACCTACGACATCGTGCAGTGGTATGGACACAAATCACAG
TTGTTTCGCTTCTTGTCAGTGCTCAAGGGCCTTGAAGATCGCTGCTTTGGCCTCTCTCCT
TCAAGGGTGAACGTCCTCCTTCAAGGCTATGGGTGGGCAGGCATGCTAGATCGCTCTTTC
GGTGTAATGATACGCACGCAAGGCTTTTCCAACGACGTACTAGTCAAGTGCTTGCTGTAC
TCCATCATGAGACAGTTTAGATATGACATGGTATA