CL1536Contig1
Contig ID CL1536Contig1
Length 598
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1536contig1 sequence.
Clone ID BP912579 BP915386
Sequence
GATGCTCTCCAAATGCCATTGTGTACAGCACATTAATCTATGGATGCGGCAGGGCTGGAA
ATGCACAACTTGCAAAGTCTTTGATGCTGGAAATGGATGCAAGGGGTTTTGAACCAGATT
GGTTAACCTACAAATGTTTGCTTGCTGGTTATGCAGTATCAGGTCGAACAGCACAAGCGT
GTCAACTTTTTGAGCAGGTCCTGCAAGATGGCCAACACTTACATGCAGAGACTTTTAAGG
TCATGCTGAAACATCTCGCAGGTGTAAACCATGCACAGGAAGCTTTTCAATACCTGCAAA
GAATGTTGGAGTTAGGTTTTGATCCAGATACACGGACTTACAAAAGTGTAAATGATGGCT
TAAGAAAAGAAGGTTTTGGGGAGGATGCTGAGAAGGTGGACGAAATGCAGCTTCTTGCTT
GCAAGGAAAGCCCTTGTAAAAATACCGGTCGCATACAGAACCATGGAAACACATTGAGGA
ACATTAACAAGATCACAGTACTGATACTTTCATGTAAGTGTAAATTGCGATAGCCTGATG
TTGAGTCCTCCACTTTTCAACATCTGTCTTGTTTGTTTCATCGGTCGGACCATAGTAC