CL1564Contig1
Contig ID CL1564Contig1
Length 743
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1564contig1 sequence.
Clone ID BP913379 BP914388 BP913720
Sequence
TCGTTGCATCGATCGGTATTGAATATGATGAAATGATGCGATTTTTTGACATAACATGAT
GTCATACAGAGTAAAACCTTTTCCCCCAAAAAGGAACTGAGTTTCAAGCCTATAAAGGTC
TGACAGAATAATTAAGAGAGGTAGCTTGGAGAAATCTGCACGGAAAGCAGATAACGTTTC
AACAACAAATCTATGAATCTTTGACAATTTTGGAATGTCGATTAAGAATGAGTTACATTG
CTCTATCATGATGGCACATTGAGGAAATCAGCACCCTATCACCCGCAACCCAGTGGGCAA
GCTAAGAGCACCAACAAAACCTTGTGCTCCATGCTAAAAAGCACTATATTTCTTTAGGTC
AAAGAGGCCAAGAGCAAAGCTCTTCCGGCATCCACCTTATACTTGATTTCATGAAAACTT
AAATGGAATCTTTCAATTCGTTAAAACATCAAGGAGTCGTCAAATGGTTTGCCAGCATGA
CAAGGTTCCAAGCTGTACACTTCTCCTTGACCAAAAGTTCCACGCAAAAGACTGTCAACT
TTGCGAGAAATGACTTTCAAAAACTGATAACTGCTTCAGCTTTCTATGTATAAACAAGGT
AGAGCTTTACCATTTACCACCTCAATCCACTGCAGATGCTTGCCTCAAAAGTAAACTGGA
CCACCAGCCATCCTGGACACATTAGTAGCTGCCGCAATGCATCTGTGGAAAGCTGTGTTT
GTATTTAAAGGCTGGAAACCTGT