CL1609Contig1
Contig ID CL1609Contig1
Length 722
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1609contig1 sequence.
Clone ID BP918942 BP913436 BP920366
Sequence
TGCATGTTTTAAAAATAACCTCTTTACATTCTCAACAGAGCACAAAATTTACAAAGATAA
AATCAACACAGCATCTGCGTGCATCATGCTTGCATCCACAAAAACACAGCACACTAGCAT
TGACAAAGCCTAAAGTGGAGGCACTGAACCAGGCCTATATGTTCAACTGATTTTGAAAAG
CATCAAGCGACAAATTACAGCCAACAAACATCCTTCAGCCTGATCATAGATAAGTTCAAC
CAACGACCCAGCTTCCATAAAGGCAAAACATAACCTGTAGAAGGTCAGCACCACATCTAT
CCCAGCCTTGGTCCGGAATGAAGCATACTCTATCGAACTTGTCGACCTAGAAGGTGAAAT
AAAACCAAGCCCAATGTTGTGTCTTCAAACTCCACTACTTTAAGTTTACTGTACAGTAAC
AGAACCCCCAAGATGGCCTGAAATCAACAATCAGACTCCCTTCAAATCGCAAGAAATTTA
TATTTGAAAGCCTCTGTCATAGCCAGCTTCGCTGCCACCATAGGAAATCATATCAAATCT
GCAACATTCATTGGCATCTCATCAATTTGAGTGCTGTAATACTGCTCTATGTCTCGAAGA
ATTCTTATATCATCAGTCCTGACAAAGTTGATAGCAACACCCTTTCTACCAAAACGACCG
GAACGCCCTATCCGGTGAATATACAACTCACGATTGTTTGGAAGATCGTAGTTGATGACC
AA