CL1651Contig1
Contig ID CL1651Contig1
Length 599
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1651contig1 sequence.
Clone ID DK960631 DK962788 DK954093
Sequence
CGCGAGAGCAGGCACTGAATAGAGATTTTGGAACTCCTGTGCGCGGAAGAGGTCTCTGCT
CTTCTTTGCGCGTGCCTGGGGAGAAACATGGCTTTAGTGGAGTGCTCTTCAGCAAACCCC
TTCGCTGACGCGCTTGAGGCTATACCCCTTGTCAAGTCAGCTTCTGGGGACATGCTCACC
AAGCCGTTTCTCGATGTCTGTCGTACGATCCTTCCAGTTCTCGATAAATTTGGAGCTGCC
ATGTCAATTGTGAAATCTGATGTAGGAGGCAACATCACGCGCCTTGATACCCGATACAGA
GAGGATACATCAGCCTGTTATCTTTTGCATGACATCGTACGCAAAGAGATTTCAGAGAAG
AAAGCAAAGAACTCCAATAGTTGTGCTAATGGTCTGTTGTGGCTGACAAGGGCTATGGAT
TTCCTTGTGGCATTATTTCAAAACTTGCTGAGCCATGCAGACTGGACAATGAGTCAGGCT
GCAACCGATGCCTACAACCTTACATTAAAGAAATGGCATGGTTGGATTGCAAGCGGAGCT
TTCACGGTGGCACTAAAGCTGGTGCCTGNAAGGACCAAGTTCATGGCTGTTCTAGGAGA