CL1667Contig1
Contig ID CL1667Contig1
Length 1018
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1667contig1 sequence.
Clone ID BP912755 DK961838 DK954843
Sequence
CGTGGGTGGTGTAAAAGAGGAAAGAACGTCGACCACAAGCTTACTTCTTCAGCTGCTCTA
GTAAAGAAAGGTTTTCAGCTGAAAGCTTTTGGCAAAGCTCACTTAGCCTTTCTACTTCCA
TCTTTAAAGAATCATTTTCCGCAGTAAGGGCCTGCACCTTCTCGGCTAGCTCGTCACACT
CAGCCTGCTTGCAGCATCCTAGATCGCCTTGCAGACTCTCTATTTGCTTCTTTCCTTCTC
TGTCGTTTCAGCTCCTTCTCATCCTGAATCCAATAGTCAGTGGAGCCTCCATCACTGCTG
GGATTATGAAAGCTCATGCTCCCTGTGGCATGTACGTAAGTACCTGGCACAGCATGTGGT
CGAGCAACATCCTGAGCAACAACCATTCCCTGTCCATTCCAATAGTCCACCCCATAGTTT
GCAGTTGGCTTCGGCATCCCCATGCTTGCAGGCAATGAAGTAGCTGTGGGTGCAGCAACT
GGCGTACTACTGTTATTCGCATCAGTATGCCCAGTTGGGATGACTAGTTTGGATGCGTCA
TCCCCGTTTGACAGAGAAGTGCCATCGAAAGCCTGATCAAAGCTTCGTTTTTGCGAAACC
TCTCCATGCTTTTCGTATTGATTCTGGGCTTCTCCTTGGCCTTCCATTTCCCTTAGTGGA
GCTTGACCAACAACCGGTCGGTTACTCAGATTCTCATCCACTGCAGCATCCCCCACAGCG
ATTCCTCTTGTTTTTGGTTTCACCACCTCAATTTTGGGCCTCACCTCATATACTGACGGA
TTTGTTTGCTGAGGCAATGAAGAAGGGGAATATCCAACTCCTGGAAGATGAGACCCGGGT
GTTCCACAAGATGCCATAGAGATACTCTAATGCGCCCAGGATCAACGCAGCCGACTCCAA
AGTGGGCAGGAAAATGCAAGCTTGATCTGGCAACGCCTGAAGAGCAGAAAGAATTCTGTC
TCCACGCTGGCTTGTGCAAAATTTCCTCTAAATTAATTAAATTTGAGCTGCACAATTG