CL1839Contig1
Contig ID CL1839Contig1
Length 1247
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1839contig1 sequence.
Clone ID DK949118 DK954427 DK950452
Sequence
GCCCATCTTTTCTTTTCGTTTTAGTAGCTGCCCGCGGTTCACCTCTTCTCCTTAGCGCGG
CTCACAGCCATCACCCTCTTGCGCATCGTGTCCTTTCCCTCATGATCCTGCTCCGCCCTG
CCCCAATATGGCCTTGCATGTCATCTGACACCAGAGATCGCCTCCTCCATGGAACCCTCT
GAGCAGTGGAACAACTCCCCAAGAGAGCTTTCTCTCAAAAGAGGCTTTATCGACGTATGG
AACAACCGCAACCGTGGTGGAGAGAATACTCTCGACGATGGGACGCTGGCGGAAGCCAGT
GGGCCTTCTAACCCAACATGGAATCCTGTCTCTGATTCTAGCCCTACGTCTAACGCCAAC
CCAAATTCAAGATTGAAAGCTACCCCTACATTTAAACATGGTGATGGCAGCAGCAGAGCC
ACCTGCGACTTGATCCCCAGCTCTATTGCGATCGCGAACCCCACCCCCATTGCAGTTGCA
AATCCCACCGTAAGGCCATCTGCGTTCCCCTCCAGGGGCACTTTATCCAATGACTTTCTC
AGGCATTTTGACTCATCAGATAACAGCGATGTCATGGATGATGGGGACGAGAGTGATGGC
AAGCGCAAGGTTCCCACATCCAAGAATCTCATGTCGGAGAGGAAGCGGAGAAAGAAGCTT
AATGAAAGACTATATTCATTACGTGCCATTGTTCCCAACATAAGCAAGATGGACAAGGCT
TCAATTGTTAGTGATGCCATAGACTACATACGCGAGCTTCAGAAGCAGGTGTGTGACATT
GAATCTGACATAGTTAGTCTCAAGTCTCAGAAGGAAAATATAGCTGCGGAAGATTCAAGG
CTAGGGGACCACAAGCATATGGATCCCTTGGCTGGCCTGAAAAAGAAAGCAAAGCAGGAG
CACTGGATAGTGGAGCTCGAGGTCTCCCAAATGGACGAGCATATCTACCACTTTCGAATA
CATTGCAAGAAGAGTCCAGGAGTGTTGATTCAGCTTTCCCGGGCACTTGAGTCTTTGGAA
TTGGAGATCGTGAATGCAACCCTCACTGCGGTTGATGATCATGTATTGAACACCGTGGTG
GTTGAGGTGAAAAATGGCTGGAGCATGAAGAGTGAAGAGCTCCGCAATCTGGCATTGGAA
GCTATCCCCAAGTTTGGGTTTATACTCGGTTGAAGGAGATTTATCCCGTCAAAACTAATT
GTGTAAAGAGCATTCGAAAAATTGTTCGATCTTGAATCAAGGTGCTC