CL1952Contig1
Contig ID CL1952Contig1
Length 524
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1952contig1 sequence.
Clone ID BP914342 BP915005
Sequence
CAGGAGTATTACAAAGAATGAGGGCGCCAGAGCATTATTAAGGGGTATGAAGCCTAGAGT
CCTATTCTACACCCCGGCTGCTGCGATCTGCTGGTCAACCTATGAAGCAAGCAAAAGCTT
CTTGCAGCAACTGAATACAAGCAAAAGAGAAGGTGCTCTCGTGTAGCTCTGCTTGTGCAT
CAGAGGGGACCTGGACGCTGGTTCGCTGCTATGATCTTTTAAGACCAAAAAGGCCGCCTT
TTGTTGTTTATGGTGCCTGCTCGTTTGTTGAAGAGAGCCTGTCGCCTTGTATGGTTGCGA
GTTTTAACAGCTATTTTGTTATCCAGTTGAGCTGGCTGGGCATCAGGATTGAAGTGTCTT
CTGAAGCTGGACGGTACACCCCAACCCCAAATGCTTAAAATGTTGAATTCTGTTCCTTGC
TGTTGTAAGAAGAGAGGTATTCTCTCCAAGTTATTGGTCCCTTCTGGTGAGGCCAATTTT
TCTCCATTGAATATTGCTGAAAAGAGGAACCAATATTGTGTATT