CL1970Contig1
Contig ID CL1970Contig1
Length 885
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1970contig1 sequence.
Clone ID DK950408 DK961794
Sequence
GCACGCTGCAGAGCATCTTGAATCTGAGGCTCAGCAGATACTGGACACCAGCCTTCACCT
ACTAAACACTTTCTCGTAACATCAACACTCAACATATTCAGTGTATGATTAACCGCCTTT
TCTCTTTTCACCGTTGAATCCCACAACTCAATATCACTGGCAATAGAAGAAAGAACGTTG
TCTCTGTGTCGATTTCCAGCATCAATTGTGGCTTTCAGCTCCAACAACCTTGCTGACACC
TCATCTAACATTTGTGCTTGTTTCCCTGCATCCTCAGGAAAGGGATATTTATTTGCACCA
AATGCTTCACATATCTTCATTATCTTCAGCTTTGCACGCTCACCAGAAAAGAAGACCAGG
AACACGATCTTTTCCATCTTTTCGCCTGTAGCAGGGTCCAAAACCGGTTCCTCAACCGGA
ACCTGTTCAAGCAGCACGTTACCACGCGTAGCGCGAAAGAGAATTCTTTCAAAAGCTGGA
GCCTTGGACTTAGCAACAAGGCCAGCGATGAAACCTAACCTTGCCTGCTTTGAAGGCTCT
TTCAACATTTCCTGTTCCAACAGTAGTGGACTTTCTATGGATTCCTCGACTCGAAATGAT
GAAGACTCTTCTAACTCCCTTTGTTGGGCACGAGCATTGCTTTGCACAGAATAAAAGAAC
ATACCAGCCTTCTGCAGCACAAGCTGAAATTCTAAAAGCTCACTATAGCTGCGCATAAGT
ATATCACTGCTGGAGTTTATACTTGTTAGCTCTATCTCCAACTCAGTCAGCTTCACCTCA
AGCTCGTCTATATCAATTTCCTTGCTTGTTAGTGTCCCTTTCGAGACAGGAATACCAGCC
TTTGCCAACTGATCTTTGAGAAAGCGCACTTTTCGGAGCATTTCT