CL2040Contig1
Contig ID CL2040Contig1
Length 911
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2040contig1 sequence.
Clone ID DK948666 DK960218
Sequence
GTGATATTCTTTCCCTGTCGTTTCTTCACCTGCTTGATCATCTGACTTCAAATTGGTATT
TGAAAGATAGCCCTCCGTAGCTTGACTATTTATCCAACGATCTAGCCATATCCAGCTCCA
TGTAGAATTGTTAAGCTCATAGTCAAATAAGGATTCCAAATTTAATCGTGACTTGGCCCG
CCATTGATTTGAGAAAGCATAGGCCAGGGCACGCTCTCGCTTGATTGAAGCCTCTTCTTT
CTGTTGTGCTCTAGCTTGAATCTCTTCAACTGATCCGATTGCATGACACCAATCCTCAAT
TTCAGCTTGTTGAGAATCTGCTGTATTGCTTGATATCTTTTGTGGTACTCCTTGACCAGC
TTTGGCTTTTAATGAGCGATGTGCACGGATTCGTGCCTGCATTCTTACAAACGTTTGGAT
AGAACGCAGACTTCCGATTGATTTATTTTGGGCATTATGCCCATTAATAGCTGCCTGTAG
CCTGACAAGGCCCTTCAAAGCACAAAGTGCTCTCCTTGCCAAGAACGCACGAAAGGCGGT
TTGAATGCGAATAGCAGCCCACTCTTCTCGTTCAGCCTGGCTTAACACAGCTTCTTCCAC
GTCGTCATCATCGTCACCTCCAAGTATTGAGCCTTTATCAATAACACGACAAGAGTTCAA
CAGGTTCCATCGGCTAGATTTCTTATGAAGGGTTACCTCACTGTTCGCAGTCTTTGATGG
AGGTGATAACTTGATCCTTATGATCGTTTTAAACCACTTTTTGGAGGCACCCATCTAGCT
TAGATGTTGCATTGAAGGGGAGAAAAAGCCTTATCACCAACAGTCCACCCTTCGACCAAA
TATTTGGGAGCACATGCCTTTATGAACTGTTCTAATAAGCTTGTAGAACTCTTGAAGTGG
GCAGAGGAAAA