CL2055Contig1
Contig ID CL2055Contig1
Length 766
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2055contig1 sequence.
Clone ID DK954081 DK961222
Sequence
GTTAAAATGGCATATATAGTTTCCAATATTTTGCTTAATGTTAATTCGATACGAACGCAG
ATAACGAAGCACTCTAGTTTTTTCGAAGAGTTTTAAATTAAAAGAGAGCGCATTTCTTTC
TTGAGCAGGAGGTGAACACGTCGTTTTTAGTGTATGTACTTGTGCCGTGCGATGAGCCAA
CTGCTCGAAAACCCACAACCCTAGAGCTGTCGGTGGAGTGCAGAGGCATCCACTCTCCCG
CTTTTTACGCCGGAGGAGGTCCTGATCGCAGTCTTTGACCCTTTTCCCGGAGATCGCCAT
CGCCTTGGACTCCGTTGTCAGGAGATCGCCATCGCCTTCGGGCTGGAGGGAAGCGACAGG
TCTCTACTGAGCTCTGTCTTTGGGTGTAGGATTCTTGGCTTCCCATTCAGCAATCATGAG
CGTGGTTGGGCTTGATGTTGGCAATGACAATTGCATTGTGGCTGTGGCTCGGCAACGTGG
CATCGATGTGGTTCTCAACGACGAGTCCAAGCGGGAGACTCCTGCCCTTGTCGCCTTTAA
TGAGAAACAGCGCTTCATTGGGACAGCAGCATCGGCATCGATCACCATGAATCCCAAGAA
CACAATTGCCCAGATCAAGCGACTGATCGGCCGCCACTTCCAGGATCCTGATGTGCAGCA
AGATATGAGTCTTCTCCCCTTTCATGTTACGGAGGCACCAGAAGGTCACCCCCTTGTTCA
CGTTCAGTACCTTGGTGAAAACAGATGCTTTACCCCTACTCAAGTT