CL2068Contig1
Contig ID CL2068Contig1
Length 522
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2068contig1 sequence.
Clone ID BP918849 BP919247
Sequence
AATGGCAACTTGCAACATAAAGTTACGGGTATAAGGAGTGGCAGTGCAGAAAGAAGCAGC
TTGGAGACTAAACGTTCGGACACGTCCTTGCCACAATCAAGAAGGCAAACGAATACTCAA
TCCAGCCCTTCTGTGCCAAATAGTTTAGATCGAGACTCTCATAGAGTGGACTTCTGGCTC
AGCAGTCCAGTGTCAAGTTCCACTCAAATGGAAGAATCTGTTAGTGATACCAATGTAAAG
AGCCATGCATTGAATGATGGTAAACCTAGAGCAGCATTTTTGGATTGATTATACGTCAGG
GGTAAAAATTCAAGAGCAAAATGTGTAAAACCTCTCAAAAGTTGATATTGCGATCACTTA
ATATCAGGATGAGTCTGTGCTCAATGGGTAAATTCATACATGTAGAAATATTACTTGAGA
GGCACAAAAGCTGTATAAATGACAATAATGTGGGCGAGAATGGCTATAGTACATCGGAAA
TATGAGGAGAGTGATATGCTTCTGTAGTTTTCAAAATAAAAA