CL2108Contig1
Contig ID CL2108Contig1
Length 747
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2108contig1 sequence.
Clone ID BP915870 DK962139
Sequence
CATTCTTGTCTTCATATGAGCCCTTGAGCTCTACAATATTGGGATGACCAGTGAGGTGGT
GCATAATTTGCACTTCTCGCCTCACATCTTCGATGTCCTCTTTATGGGTCAGCTTGCGCT
TTGATATTGACTTGCATGCAAATAACTCCCCTGTGGCTTTATTCGTGCACAGACGGGTTA
CTCCAAACTGGCCACGGCCAAGCTCTCTTCCCAGCGAATATGTATCCCGTACCTCTTCCA
TTGGCTTGTTCAGCACGTGGCCTATGGCTTGTTTGGAGGACTGAGAAGATGTATGAGATG
AAACATCTTGCTTTGGGCGAGTTGCGGTGGAAGGTCCCGATGAGCCTGATAAAGTGGCAG
GCATGGCTGTCTGGGAAGATTGCTCGCTCCCATTTAGATGTTTGCGATGTCGCCCCTTGT
GCCTGCTGCTAATTTGGTTGCCCATGGTAGATAATCTCTTTAGTTGCTATGCAGGACCTG
TTTGGTGATGATAAACGATTGAATATACCGATCTGTTGATTGCGGATAACTAGCGGCTAC
GCGAGGATTGAAAGTCAATGACCAGCTAGTTGGAGTTGAATGCTTGATATTTACTACGGA
GCTCCATTCACTCACTGCTTCAATCGGGTTGCTCTACTTCCTCATCACAGATTCTGCAGA
GCCTGCCTGCCTTTCAACCTCCTCGCTTACCAGATCTGATGGTGACGAAGCGTACTGCTT
GAAGAAATGGCATGATGACGTTCTGAT