CL2185Contig1
Contig ID CL2185Contig1
Length 959
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2185contig1 sequence.
Clone ID DK949702 DK956017
Sequence
ACAAAAAATCATGTATGAGTGCCACTCTCAATAAATGATACTGCCACCGGCGGCAGGGGC
ACGCCAGATAGGATGAGACTACGGAATGGGGTAAGACACAACCCACAAGACCACAACACA
GACTCGTAAACTCATACTACTTCACCAGCCTTTACAAGCAATGATGCTTGATGTGCTAAG
CCTGCTAACCAGGCCTTTTGAAGGATAGAGAAGCGGTTGATAATTCTCGAGAATGTTCTC
TTTCAAGATCCGGAACAGAGCTTTTGAGGGCAGGCACACGAATTGCCAAGGTCTTGTAAA
GGCGTGCATACCGTGCTCGTGTACCATCCGCAGTCCTTGCCAAAGCTAGCTGACTAAACG
CTTCTGGTAGTCGCGTGAGTACTAATTTGATCTCCTCCAGAGACAATCCAGCCAGCGTTG
ATGGAGCCGGCACGATCGCCACCACTTCTTTCCCGGTCTTATCCTGGACTTTTGCTTGGG
CCTTCACAACAAGCTCGAGAGACGATGTCGCACCACACTTAATAACGAAAGGACTAGCAG
ACCCATTGTTGAATTGCAAGACACTCCACTGCATCACATCGCCATCTGCTCCAATGAGGT
TCTGATCTCCCCAGTCACCTGACATTGCTGACAACTCTCCTGTGCCATCATCCCCAGAGG
CTCTCGCACGAGTGTGATGAGGCCCTTCCCGTTGCTCAGCTATTGACTCAACAGCCCTCC
TTGCCTCCAGTATGTGCTTTTGTGCACAAGGATGATCTATGGATAACAGAGCTGGCATCC
TATCTGATAGAGCATGAAGCGCAGAAAGCATCATTTGCTTTCTGGCAGCAAATATTGCTT
TAACTGGCGCATCTCTCTTGATGTCTTCAGCTTGTTTGACGATTTCCTCCAGTGACATCA
GAGATGCTATTCGTGCATCTTCACTTGCAGTGGATGGGTTTCGGATGGGTGAACCACCC