CL2271Contig1
Contig ID CL2271Contig1
Length 809
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2271contig1 sequence.
Clone ID BP912597 DK949755
Sequence
GTTTCACCAGTGGGCGCCCATCTGGATAAGCGTAGGGGCAGCAAAGGGTGAAGATATGAC
TAGAATTGTGGTGGGCATAGCTGTTGCATCAGCGGCAGTGGCTTGTGCAGCTGCTGCATA
TGTGGTCAGCAGGCGCATTCGAAGCCGCAAGCATTGGAATCGGACTTTGGGCATTTTACA
GGAGTTCCAGAGTGAGAGTGCCACTTCCCTGTTACGCTTGCGCCAGGTTGTGGATGCCAT
GACCGTGGAAATGCATGCCGGCCTCGCATCAGAGGGAGGAAGCAAGCTGAAAATGCTGCT
TAGTTATGTTGACAACCTTCCAACTGGGGACGAGGAGGGTCTGTACTATGCTCTTGATCT
AGGGGGAACCAATTTTAGAGTACTTCGGGTTCAGTTGGGTGGTCGGGAAGGCAGAGTACT
AAGGCAAGAGTATGAAGAAGTACCCATACCTTCGCAGCTTATGGTTGGCTCCAATGAGGA
CCTCTTTGATTATATTGCTCTCGAATTATCAAGGTTTGTGGAGTCTGAAGGTGATGGATA
TCATCCTAAATCCGGCCAAGAACGGGAGCTTGGATTTACTTTCTCTTTTCCTGTAAAGCA
GACATCTGTTGATTCAGGATATTTGATCAAGTGGACAAAGGGCTTTGCAATTTCGGATGG
GGTTGGGAAAGACGTTGTGCAATCCTTACACGATGCTATGAAAAGACAAGGCTTGGACAT
GAGAGTGGCAGCTTTGGTCAATGACACAGTTGGTACCTTAGCTGGTGCCAGATATTGGAA
CGAAGATGTGATGGTGGCAGTGATCCTAG