CL2323Contig1
Contig ID CL2323Contig1
Length 1014
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2323contig1 sequence.
Clone ID DK961054 DK962726
Sequence
AGGGATCAGGAACTTGCATTCTTCGAGCCCCACCAATAGCTGGATGTGGCACATCTCCAT
CCCCACCAATCTCATTACTTGTGTCAACTATTACCACCCTCTTATGAAGCTCATCCGCAA
GAACACGAGCTATTTCCCGTATGACAGTTGTTTTCCCCACTCCTGGCCTTCCAAGAAATA
AAATGCTTTGACCAAGATGGAGGAGATTACGAGCCATATCAACATGCCCAGTCACAGCCC
GGCCAACCCTACATGTAAGCCCAACAATAGCTCCCTTTCTACTGCGAATAGCTGAGATCC
TGTGGAGTGTGCCTTCAATGCCGGCACGATTGTCTCCCCCAAAGTCCCCTACAGCTGATT
GAGCTGCATCAAGATCTTCTCTGGTGATCTCTTCACTTCGCAGAAACTCTCCTCCACCAT
CACCCAAAAAGCGGGCTTCAGGCCGCCTGCCAAGATCAAGAACCACCTCAAGAAGCTCCG
ACCTTCGAGGGTGGGTAAGCAAGTTGTCTCTAACATCCACTGGCAAGACTTGCAACAGAG
CGTCAAGATCATCACAGACAACAATAGCTCCATCATGGGTAACGCATTGCTCAAATTCTT
CATCTTGACCCAAAGAATCTCCATTGGCACCACTTGATCTTGCAACTAGCAGCTCGATCC
TAGCAGAACTACTTGGCTCTCTGTACAGAGTCTTCGAAGATAAAGCTCCTCCATCTCCAC
CTGCTCTTGAGAACGCCAATGGCTTCAAAGGACTTCGTACTCCAGCAAAAGCACGGTTGC
AGAAGAGGATGGGAACCTCAGAACAGCACCGAGCAGAAGAAAACTCCAGACAGAGAGCTC
TGTGAGCACGCATGGTGCAGGACTGAGGCTCCAGAGAGGCTGGTGTGAATGAAAGCACAA
TTCAGACGCAGAAACAAGGCGACTGAGCTCAGCAGAATAAGAATGAGGTCAACTAAGGGA
TCTGAGCAGCAATACGAAAGAAGATACAGCGCTTCTCAGCAATTCGTGTTGCGC