CL2501Contig1
Contig ID CL2501Contig1
Length 758
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2501contig1 sequence.
Clone ID BP914112 BP918543
Sequence
TGAAAAGTATGCAGAGGTGGTGGCTGACAAGGTAAAGCATGTAGAAACCTTGATGGAGCA
GCTTGCAGACAAAGAGAAGGACATGGAGGGCTTTCTTCAAGAGCTCAAAGACAAAGTGAG
TCTCCTCAACAAGAAGCTCGAATGTGAGCGAAGTGAGAAATCTCGACTCTCTGAACTGCA
GGGTAATATGAAATACAAGCTTTTGAAGGGCTTGCGAAAGAAGGAACAGAAGTTGGAAGA
GGAAATCGAGGGAATGAAAGAGAGGCTGGAGGAGATGCAAACTACTATTGCTCAGAAAGA
TGAAAGATTGGCGTCTATGGAAGATGAAGTGAATTCCAAATGTGCTCAGCTGGTTCAAGA
AAAGCAGAAATGGAACATGGCAATCAAAGAGGTAAAGCAAAAGGCTGCGAAGACAATCCT
GCGCTTTATGCACGGTAAAGAAAATGGGCTGCTCGAGTATCTCCGAGAGCGAAAGAAAGG
CCACAAGGCAGGTGAAGCTCGAGGAGGTTTGTTGTACAAAACAGATGATGATCGTGATGA
TGACGACGATGATTGTGAAAACAAGGTCTCTCAGATGTACCAAGAAGGATTAAGCAAGAA
GATCCTTAGAGAGAAGCTTTACAGCAAGAAGAGAATGTTGTCTGGCAGGTTGGACAGCCC
TAGGGACTCACAACAACTGTTGTCAAGTAACTTCGACGACATGGCAGACTTAAGAAGCTC
ATTTGAATCACAGAAAGAGATGGCAAGGCAAGGATTGT